Stem-loop sequence dev-mir-D24

AccessionMI0023603 (change log)
DescriptionDuck enteritis virus miR-D24 stem-loop
Stem-loop
   ggac              uuu            u 
5'     cguucgcacucugg   ccaauaauauau a
       ||||||||||||||   ||||||||||||  
3'     gcaagcgugagacu   gguuauuauaua u
   --cc              -uc            a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D24-3p

Accession MIMAT0028201
Sequence

45 - 

auuggcuucagagugcgaacgc

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).