Stem-loop sequence mes-MIR156a

AccessionMI0024207 (change log)
DescriptionManihot esculenta miR156a stem-loop
Gene family MIPF0000008; MIR156
Literature search

6 open access papers mention mes-MIR156a
(19 sentences)

Stem-loop
      a          -    a        g         cgu      c 
5' agg gggugacaga agag gugagcac cauggcuuu   gcaugg u
   ||| |||||||||| |||| |||||||| |||||||||   ||||||  
3' ucc cccgcugucu ucuc cacucgug guaucgaag   cguacu g
      a          a    c        a         -uu      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold10493: 934623-934718 [-]
intergenic
Database links

Mature sequence mes-miR156a

Accession MIMAT0029165
Sequence

8 - 

ugacagaagagagugagcac

 - 27

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).