Stem-loop sequence mes-MIR156c

AccessionMI0024209 (change log)
DescriptionManihot esculenta miR156c stem-loop
Gene family MIPF0000008; MIR156
Literature search

6 open access papers mention mes-MIR156c
(17 sentences)

Stem-loop
           -a             a  u   auu   uu     a 
5' ggugacag  agagagugagcac ca ggu   uuc  gcaug a
   ||||||||  ||||||||||||| || |||   |||  |||||  
3' ccacuguc  ucucucacucgug gu ucg   aag  cguac u
           ga             c  c   ---   cu     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold07859: 647750-647835 [-]
intergenic
Database links

Mature sequence mes-miR156c

Accession MIMAT0029167
Sequence

3 - 

ugacagaagagagugagcac

 - 22

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).