Stem-loop sequence mes-MIR156d

AccessionMI0024210 (change log)
DescriptionManihot esculenta miR156d stem-loop
Gene family MIPF0000008; MIR156
Literature search

6 open access papers mention mes-MIR156d
(17 sentences)

Stem-loop
            -             u         cgu      a 
5' ggugacaga agagagugagcac uaugguuuu   gcaugg u
   ||||||||| ||||||||||||| |||||||||   ||||||  
3' cuacugucu ucucucacucgug guaucgaag   cguacu c
            a             u         -uu      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold07318: 232145-232230 [-]
intergenic
Database links

Mature sequence mes-miR156d

Accession MIMAT0029168
Sequence

3 - 

ugacagaagagagugagcac

 - 22

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).