Stem-loop sequence mes-MIR156g

AccessionMI0024213 (change log)
DescriptionManihot esculenta miR156g stem-loop
Gene family MIPF0000008; MIR156
Literature search

7 open access papers mention mes-MIR156g
(20 sentences)

Stem-loop
            -             a  u   auu   cu     ac 
5' ggugacaga agagagugagcac ca ggc   uuc  gcaug  u
   ||||||||| ||||||||||||| || |||   |||  |||||   
3' ccacugucu ucucucauucgug gu ucg   aag  cguac  u
            a             c  c   ---   cu     au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold00206: 357293-357380 [+]
intergenic
Database links

Mature sequence mes-miR156g

Accession MIMAT0029171
Sequence

3 - 

ugacagaagagagugagcac

 - 22

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).