Stem-loop sequence mes-MIR156h

AccessionMI0024214 (change log)
DescriptionManihot esculenta miR156h stem-loop
Gene family MIPF0000008; MIR156
Literature search

6 open access papers mention mes-MIR156h
(17 sentences)

Stem-loop
   u         -              u  -   u     auaa 
5'  ugacagaag auagagagcacaga ga uga augca    u
    ||||||||| |||||||||||||| || ||| |||||    g
3'  acugucuuc uaucucucguguuu cu acu uacgu    g
   u         g              c  c   c     cuca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold12711: 213693-213777 [-]
intergenic
Database links

Mature sequence mes-miR156h

Accession MIMAT0029172
Sequence

1 - 

uugacagaagauagagagcac

 - 21

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).