Stem-loop sequence mes-MIR156j

AccessionMI0024216 (change log)
DescriptionManihot esculenta miR156j stem-loop
Gene family MIPF0000008; MIR156
Literature search

6 open access papers mention mes-MIR156j
(17 sentences)

Stem-loop
   u          -             u  u a   a     ua 
5'  ugacagaaga uagagagcacaga ga g uga augca  a
    |||||||||| ||||||||||||| || | ||| |||||  a
3'  acugucuucu aucucucguguuu cu c acu uacgu  g
   u          c             c  - -   c     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold06871: 276857-276940 [-]
intergenic
Database links

Mature sequence mes-miR156j

Accession MIMAT0029174
Sequence

1 - 

uugacagaagauagagagcac

 - 21

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).