Stem-loop sequence mes-MIR159b

AccessionMI0024218 (change log)
DescriptionManihot esculenta miR159b stem-loop
Gene family MIPF0000010; MIR159
Literature search

6 open access papers mention mes-MIR159b
(20 sentences)

Stem-loop
         a   a            aa       ua        u   -----      auu     g u   c    g ua      c       cauaauaaa      uu   uu 
5' aggguu aga guggagcuccuu  aguccaa  gaggaucu gca     ggguag   gagcu c gag uaug a  ccacag ccuaucc         agggag  cuu  u
   |||||| ||| ||||||||||||  |||||||  |||||||| |||     ||||||   ||||| | ||| |||| |  |||||| |||||||         ||||||  |||   
3' uucuaa ucu caucucgaggga  uuagguu  uuccuaga ugu     uccauu   uucga g cuc auac u  gguguu ggauagg         uucuuc  gaa  u
         a   a            ag       ug        u   auuau      -ac     g u   u    g uc      c       ---------      -u   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold06631: 235018-235235 [-]
intergenic
Database links

Mature sequence mes-miR159b

Accession MIMAT0029176
Sequence

186 - 

uuuggauugaagggagcucua

 - 206

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).