Stem-loop sequence mes-MIR159c

AccessionMI0024219 (change log)
DescriptionManihot esculenta miR159c stem-loop
Gene family MIPF0000010; MIR159
Literature search

6 open access papers mention mes-MIR159c
(19 sentences)

Stem-loop
        u    u    uu                c    uac        a   g      gguag      g  g    u     aau    cug   g   aggauaa   ga 
5' ggguu uugg gagg  uaauggagcucucuuc cucc   uguaaagg ggc aaggua     gccaug cu ccag ucaug   accc   ggu ugc       gca  g
   ||||| |||| ||||  |||||||||||||||| ||||   |||||||| ||| ||||||     |||||| || |||| |||||   ||||   ||| |||       |||  a
3' ucuaa aauc uucu  guugucucgagggaag gagg   auauuuuu ccg uucuau     uggugc ga gguc aguac   uggg   ucg acg       cgu  g
        c    u    --                u    -uu        a   g      -----      a  g    c     guu    -aa   g   -------   ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03581: 941900-942114 [-]
intergenic
Database links

Mature sequence mes-miR159c

Accession MIMAT0029177
Sequence

177 - 

auuggagugaagggagcucug

 - 197

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).