Stem-loop sequence mes-MIR159d

AccessionMI0024220 (change log)
DescriptionManihot esculenta miR159d stem-loop
Gene family MIPF0000010; MIR159
Literature search

6 open access papers mention mes-MIR159d
(19 sentences)

Stem-loop
           a            u          g  aau     g     g  g    u     aau    c   -g        gugcaggauaagcagauaucgauu 
5' uaauggag ucucuucacucc auguaaagga gc   gguag ccaug cu cuag ucaug   accc ugg  ugcgcacu                        g
   |||||||| |||||||||||| |||||||||| ||   ||||| ||||| || |||| |||||   |||| |||  ||||||||                        a
3' guugucuc agggaagugagg uauauuuuuu cg   ccguu ggugc ga gguc aguac   uggg auc  acgcgugg                        u
           g            u          a  guu     -     a  g    c     guu    a   gg        guucgguuaggguauuauuaguac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold02658: 496637-496853 [-]
intergenic
Database links

Mature sequence mes-miR159d

Accession MIMAT0029178
Sequence

194 - 

auuggagugaagggagcucug

 - 214

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).