Stem-loop sequence mes-MIR160a

AccessionMI0024221 (change log)
DescriptionManihot esculenta miR160a stem-loop
Gene family MIPF0000032; MIR160
Literature search

7 open access papers mention mes-MIR160a
(23 sentences)

Stem-loop
       c       c          aa  u g   u  a   - a 
5' augc uggcucc uguaugccac  gc a agu ca ucc c u
   |||| ||||||| ||||||||||  || | ||| || ||| |  
3' uacg accgagg gcgugcggug  cg u ucg gu agg g c
       a       a          gc  c g   -  c   u a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold10183: 164216-164301 [-]
intergenic
Database links

Mature sequence mes-miR160a

Accession MIMAT0029179
Sequence

2 - 

ugccuggcucccuguaugcca

 - 22

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).