Stem-loop sequence mes-MIR160b

AccessionMI0024222 (change log)
DescriptionManihot esculenta miR160b stem-loop
Gene family MIPF0000032; MIR160
Literature search

7 open access papers mention mes-MIR160b
(21 sentences)

Stem-loop
       c       c              -aaa   --      a 
5' gugc uggcucc uguaugccaccugc    gcu  caucaa a
   |||| ||||||| ||||||||||||||    |||  ||||||  
3' uacg accgagg gcguacgguggacg    cgg  gugguu a
       u       a              ccuc   cg      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold02954: 10603-10687 [+]
intergenic
Database links

Mature sequence mes-miR160b

Accession MIMAT0029180
Sequence

2 - 

ugccuggcucccuguaugcca

 - 22

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).