Stem-loop sequence mes-MIR160c

AccessionMI0024223 (change log)
DescriptionManihot esculenta miR160c stem-loop
Gene family MIPF0000032; MIR160
Literature search

7 open access papers mention mes-MIR160c
(20 sentences)

Stem-loop
   -  c     c       c          aa  u g   u      cc 
5'  gg uaugc uggcucc uguaugccgc  gc a agu caaucc  a
    || ||||| ||||||| ||||||||||  || | ||| ||||||  c
3'  cc auacg accgagg gcgugcggug  cg u ucg guuagg  u
   c  -     a       a          gc  u g   -      ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold08404: 8406-8499 [-]
intergenic
Database links

Mature sequence mes-miR160c

Accession MIMAT0029181
Sequence

6 - 

ugccuggcucccuguaugccg

 - 26

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).