Stem-loop sequence mes-MIR160d

AccessionMI0024224 (change log)
DescriptionManihot esculenta miR160d stem-loop
Gene family MIPF0000032; MIR160
Literature search

8 open access papers mention mes-MIR160d
(21 sentences)

Stem-loop
         c       cu          ug a   c   c  ga 
5' auaugc uggcucc  guaugccauu  c gag cca cg  g
   |||||| |||||||  ||||||||||  | ||| ||| ||   
3' uauacg accgagg  uaugcgguag  g cuc ggu gc  a
         u       ag          gu c   c   a  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold00271: 120302-120387 [-]
intergenic
Database links

Mature sequence mes-miR160d

Accession MIMAT0029182
Sequence

4 - 

ugccuggcucccuguaugcca

 - 24

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).