Stem-loop sequence mes-MIR160e

AccessionMI0024225 (change log)
DescriptionManihot esculenta miR160e stem-loop
Gene family MIPF0000032; MIR160
Literature search

7 open access papers mention mes-MIR160e
(20 sentences)

Stem-loop
         c         ga      uc       c       ag 
5' gccugc uggcucccu  augcca  uaagaag uugucaa  a
   |||||| |||||||||  ||||||  ||||||| |||||||   
3' cggacg acugaggga  uacggu  auucuuc gacgguu  a
         a         ag      uc       c       gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold04163: 47842-47929 [-]
intergenic
Database links

Mature sequence mes-miR160e

Accession MIMAT0029183
Sequence

4 - 

ugccuggcucccugaaugccauc

 - 26

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).