Stem-loop sequence mes-MIR160g

AccessionMI0024227 (change log)
DescriptionManihot esculenta miR160g stem-loop
Gene family MIPF0000032; MIR160
Literature search

7 open access papers mention mes-MIR160g
(20 sentences)

Stem-loop
         c       c              aa  cu    aga 
5' gugugc uggcucc uguaugccaucugc  ag  cauc   a
   |||||| ||||||| ||||||||||||||  ||  ||||    
3' cguacg accgagg gcguacgguagacg  uc  gugg   a
         u       a              cc  cg    cug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold02960: 648590-648675 [-]
intergenic
Database links

Mature sequence mes-miR160g

Accession MIMAT0029185
Sequence

4 - 

ugccuggcucccuguaugccauc

 - 26

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).