Stem-loop sequence mes-MIR162

AccessionMI0024229 (change log)
DescriptionManihot esculenta miR162 stem-loop
Gene family MIPF0000127; MIR162_1
Literature search

3 open access papers mention mes-MIR162
(5 sentences)

Stem-loop
        g    c    c       ucuuccuggaggauuuuguugu 
5' cugga gcag gguu aucgauc                      g
   ||||| |||| |||| |||||||                       
3' gaccu cguc ccaa uagcuag                      g
        a    u    a       cuaaguacacaaacacaauuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold07762: 294285-294376 [-]
intergenic
Database links

Mature sequence mes-miR162

Accession MIMAT0029187
Sequence

72 - 

ucgauaaaccucugcauccag

 - 92

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).