Stem-loop sequence mes-MIR164a

AccessionMI0024230 (change log)
DescriptionManihot esculenta miR164a stem-loop
Gene family MIPF0000045; MIR164
Literature search

6 open access papers mention mes-MIR164a
(21 sentences)

Stem-loop
      -   u     u  c        ca                u 
5' ggg gag agcuc ug uggagaag  gggcacgugcaauuuc c
   ||| ||| ||||| || ||||||||  ||||||||||||||||  
3' ccc cuc uuggg ac accucuuc  cucgugcacguuaaag u
      a   u     u  a        cc                c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold11668: 1885-1973 [+]
intergenic
Database links

Mature sequence mes-miR164a

Accession MIMAT0029188
Sequence

17 - 

uggagaagcagggcacgugca

 - 37

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).