Stem-loop sequence mes-MIR164b

AccessionMI0024231 (change log)
DescriptionManihot esculenta miR164b stem-loop
Gene family MIPF0000045; MIR164
Literature search

6 open access papers mention mes-MIR164b
(20 sentences)

Stem-loop
   gc              ca             ----uucua    uuc 
5'   ucauguuggagaag  gggcacgugcaaa         uggc   u
     ||||||||||||||  |||||||||||||         ||||   c
3'   ggugcaaccucuuc  cucgugcacguuu         accg   a
   -u              cc             ucucaacuc    uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold08265: 3337304-3337395 [+]
intergenic
Database links

Mature sequence mes-miR164b

Accession MIMAT0029189
Sequence

9 - 

uggagaagcagggcacgugca

 - 29

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).