Stem-loop sequence mes-MIR164c

AccessionMI0024232 (change log)
DescriptionManihot esculenta miR164c stem-loop
Gene family MIPF0000045; MIR164
Literature search

6 open access papers mention mes-MIR164c
(20 sentences)

Stem-loop
          a  cu  -  c        ca             ----cucc     uuc 
5' ggguggg ag  cc ug uggagaag  gggcacgugcaaa        auggc   u
   ||||||| ||  || || ||||||||  |||||||||||||        |||||   c
3' cccacuc uc  gg ac accucuuc  cucgugcacguuu        uaccg   a
          c  -u  u  a        cc             ucucuacu     uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold04457: 369765-369875 [+]
intergenic
Database links

Mature sequence mes-miR164c

Accession MIMAT0029190
Sequence

18 - 

uggagaagcagggcacgugca

 - 38

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).