Stem-loop sequence mes-MIR164d

AccessionMI0024233 (change log)
DescriptionManihot esculenta miR164d stem-loop
Gene family MIPF0000045; MIR164
Literature search

6 open access papers mention mes-MIR164d
(21 sentences)

Stem-loop
      u         g            u    cua    c  u 
5' cca gcuggagaa cagggcacaugc aaau   ucag au a
   ||| ||||||||| |||||||||||| ||||   |||| ||  
3' ggu cgaccucuu gucccguguacg uuua   aguc ua u
      u         a            c    -ag    -  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold06700: 167813-167896 [+]
intergenic
Database links

Mature sequence mes-miR164d

Accession MIMAT0029191
Sequence

7 - 

uggagaagcagggcacaugcu

 - 27

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).