Stem-loop sequence mes-MIR166a

AccessionMI0024234 (change log)
DescriptionManihot esculenta miR166a stem-loop
Gene family MIPF0000004; MIR166
Literature search

6 open access papers mention mes-MIR166a
(16 sentences)

Stem-loop
       a        uu      cu   u         --  ga   u 
5' guug ggggaaug  gucugg  cga gucauucau  gu  agc c
   |||| ||||||||  ||||||  ||| |||||||||  ||  ||| a
3' caac ccccuuac  cggacc  gcu uaguaagua  ca  uug a
       c        uu      ag   u         gu  -a   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold11998: 298832-298923 [+]
intergenic
Database links

Mature sequence mes-miR166a

Accession MIMAT0029192
Sequence

67 - 

ucggaccaggcuucauucccc

 - 87

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).