Stem-loop sequence mes-MIR166b

AccessionMI0024235 (change log)
DescriptionManihot esculenta miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

7 open access papers mention mes-MIR166b
(18 sentences)

Stem-loop
        a        cu             c      cuu  aac   a 
5' aguug ggggaaug  gucugguucgaga cauuca   gg   uuu c
   ||||| ||||||||  ||||||||||||| ||||||   ||   |||  
3' ucaac ccccuuac  cggaccaggcucu guaagu   uc   aaa u
        c        uu             a      -cu  gac   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold10563: 539461-539557 [-]
intergenic
Database links

Mature sequence mes-miR166b

Accession MIMAT0029193
Sequence

71 - 

ucggaccaggcuucauucccc

 - 91

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).