Stem-loop sequence mes-MIR166c

AccessionMI0024236 (change log)
DescriptionManihot esculenta miR166c stem-loop
Gene family MIPF0000004; MIR166
Literature search

6 open access papers mention mes-MIR166c
(17 sentences)

Stem-loop
   u           uu         a   ---uca     u 
5'  ugaggggaaug  gucugguuc agg      uauga g
    |||||||||||  ||||||||| |||      |||||  
3'  acuccccuuac  cggaccagg ucc      auauu c
   a           uu         c   ucuuug     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold07330: 39223-39299 [-]
intergenic
Database links

Mature sequence mes-miR166c

Accession MIMAT0029194
Sequence

53 - 

ucggaccaggcuucauucccc

 - 73

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).