Stem-loop sequence mes-MIR166d

AccessionMI0024237 (change log)
DescriptionManihot esculenta miR166d stem-loop
Gene family MIPF0000004; MIR166
Literature search

6 open access papers mention mes-MIR166d
(16 sentences)

Stem-loop
   u  a        uu      cu   g   u  -- uu    ------     uuacau 
5'  ug ggggaaug  gucugg  cga gac cu  c  uuga      ugcuu      a
    || ||||||||  ||||||  ||| ||| ||  |  ||||      |||||       
3'  ac ccccuuac  cggacc  gcu cug ga  g  aacu      acgaa      c
   a  c        uu      ag   g   u  uc uc    aguuau     ucuaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03581: 311203-311312 [-]
intergenic
Database links

Mature sequence mes-miR166d

Accession MIMAT0029195
Sequence

86 - 

ucggaccaggcuucauucccc

 - 106

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).