Stem-loop sequence mes-MIR166e

AccessionMI0024238 (change log)
DescriptionManihot esculenta miR166e stem-loop
Gene family MIPF0000004; MIR166
Literature search

6 open access papers mention mes-MIR166e
(16 sentences)

Stem-loop
        a        cu             c      cu   aacaua 
5' aguug ggggaaug  gucugguucgaga cauuca  ugg      u
   ||||| ||||||||  ||||||||||||| ||||||  |||      u
3' ucaac ccccuuac  cggaccaggcucu guaagu  auc      c
        c        uu             a      -c   gacaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold01551: 925753-925848 [+]
intergenic
Database links

Mature sequence mes-miR166e

Accession MIMAT0029196
Sequence

70 - 

ucggaccaggcuucauucccc

 - 90

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).