Stem-loop sequence mes-MIR166f

AccessionMI0024239 (change log)
DescriptionManihot esculenta miR166f stem-loop
Gene family MIPF0000004; MIR166
Literature search

6 open access papers mention mes-MIR166f
(16 sentences)

Stem-loop
   u  a        uu      cu   g c        agaucuaugauuuuaucucugaaaucauuaauu 
5'  ug ggggaaug  gucugg  cga g cacuaacu                                 u
    || ||||||||  ||||||  ||| | ||||||||                                 a
3'  ac ccccuuac  cggacc  gcu c gugauuga                                 a
   a  c        uu      ag   g a        guacuauuuaguauagaguuguugcuuuuacuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold00977: 63690-63830 [+]
intergenic
Database links

Mature sequence mes-miR166f

Accession MIMAT0029197
Sequence

117 - 

ucggaccaggcuucauucccc

 - 137

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).