Stem-loop sequence mes-MIR166h

AccessionMI0024241 (change log)
DescriptionManihot esculenta miR166h stem-loop
Gene family MIPF0000004; MIR166
Literature search

7 open access papers mention mes-MIR166h
(18 sentences)

Stem-loop
                 uu      cu     cg       u   --aucuuu         --c   -     uua 
5' gguugaugggaaug  guuugg  cgagg  auauagg uug        uaucuuuga   uuc uggga   u
   ||||||||||||||  ||||||  |||||  ||||||| |||        |||||||||   ||| |||||    
3' ccaacugcccuuac  cggacc  gcucu  uguaucc gau        auagaaacu   aag gcucu   u
                 uu      ag     aa       c   auauauau         uaa   u     uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05979: 357827-357971 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR166h
mes-MIR166iscaffold05979: 357653-357772 [+]
mes-MIR166hscaffold05979: 357827-357971 [+]
Database links

Mature sequence mes-miR166h

Accession MIMAT0029199
Sequence

119 - 

ucggaccaggcuucauucccgu

 - 140

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).