Stem-loop sequence mes-MIR166i

AccessionMI0024242 (change log)
DescriptionManihot esculenta miR166i stem-loop
Gene family MIPF0000004; MIR166
Literature search

6 open access papers mention mes-MIR166i
(16 sentences)

Stem-loop
        u   --u    a       uu g    cu u    a     -aag g   ga  a 
5' auggu guu   uuga gggaaug  g cugg  c aggc uucac    u ugg  ga g
   ||||| |||   |||| |||||||  | ||||  | |||| |||||    | |||  || a
3' uacca uaa   aacu cccuuac  c gacc  g uucg aggug    a acu  cu a
        u   uau    c       uu g    ag u    a     acga g   ag  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05979: 357653-357772 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR166i
mes-MIR166iscaffold05979: 357653-357772 [+]
mes-MIR166hscaffold05979: 357827-357971 [+]
Database links

Mature sequence mes-miR166i

Accession MIMAT0029200
Sequence

84 - 

uuggaccaggcuucauucccc

 - 104

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).