Stem-loop sequence mes-MIR167b

AccessionMI0024244 (change log)
DescriptionManihot esculenta miR167b stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

5 open access papers mention mes-MIR167b
(21 sentences)

Stem-loop
      c      u           g        -aaac        cuuuaua 
5' cca uagcag ugaagcugcca caugaucu     uuccuuuu       a
   ||| |||||| ||||||||||| ||||||||     ||||||||        
3' ggu guuguc acuucgauggu guacuaga     aaggaaaa       u
      a      c           -        cuaga        cuacguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold11998: 665663-665764 [-]
intergenic
Clustered miRNAs
< 10kb from mes-MIR167b
mes-MIR167cscaffold11998: 669702-669809 [-]
mes-MIR167bscaffold11998: 665663-665764 [-]
Database links

Mature sequence mes-miR167b

Accession MIMAT0029202
Sequence

12 - 

ugaagcugccagcaugaucu

 - 31

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).
2
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).