Stem-loop sequence mes-MIR167c

AccessionMI0024245 (change log)
DescriptionManihot esculenta miR167c stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

5 open access papers mention mes-MIR167c
(20 sentences)

Stem-loop
         ag    a    - -c            cuuugguuagagggaaagaga 
5' gggaaa  guga gcug c  agcaugaucuag                     a
   ||||||  |||| |||| |  ||||||||||||                      
3' uccuuu  cacu cgac g  ucguacuggauc                     g
         cu    c    a uc            aaucccaaucauuuuaguugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold11998: 669702-669809 [-]
intergenic
Clustered miRNAs
< 10kb from mes-MIR167c
mes-MIR167cscaffold11998: 669702-669809 [-]
mes-MIR167bscaffold11998: 665663-665764 [-]
Database links

Mature sequence mes-miR167c

Accession MIMAT0029203
Sequence

10 - 

ugaagcugccagcaugaucua

 - 30

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).