Stem-loop sequence mes-MIR167d

AccessionMI0024246 (change log)
DescriptionManihot esculenta miR167d stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

5 open access papers mention mes-MIR167d
(21 sentences)

Stem-loop
      g    a u   a       g          acuua     a 
5' cca uagc g uga gcugcca caugaucuga     ucucu c
   ||| |||| | ||| ||||||| ||||||||||     |||||  
3' ggu gucg c acu cgauggu guacuagacu     aggga c
      a    c u   c       -          -auaa     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold09347: 45566-45653 [-]
intergenic
Database links

Mature sequence mes-miR167d

Accession MIMAT0029204
Sequence

12 - 

ugaagcugccagcaugaucuga

 - 33

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).