Stem-loop sequence mes-MIR167e

AccessionMI0024247 (change log)
DescriptionManihot esculenta miR167e stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

5 open access papers mention mes-MIR167e
(20 sentences)

Stem-loop
         -    c      u      u    g         ag        gacu   uu   uu 
5' ucgugu acca uaguag ugaagc gcca caugaucug  cuuuccuu    auc  aua  g
   |||||| |||| |||||| |||||| |||| |||||||||  ||||||||    |||  |||   
3' aguacg uggu guuauc acuucg uggu guacuagau  gagaggag    uag  uau  a
         a    c      c      u    -         ca        -gcc   -c   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03802: 653294-653419 [-]
intergenic
Database links

Mature sequence mes-miR167e

Accession MIMAT0029205
Sequence

19 - 

ugaagcugccagcaugaucuga

 - 40

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).