Stem-loop sequence mes-MIR167f

AccessionMI0024248 (change log)
DescriptionManihot esculenta miR167f stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

5 open access papers mention mes-MIR167f
(20 sentences)

Stem-loop
         -    c      a      u    g          g     g  ---aau     uau 
5' ucgugu acca uagcag ugaagc gcca caugaucuga cuuuc uu      uaucc   a
   |||||| |||| |||||| |||||| |||| |||||||||| ||||| ||      |||||   c
3' aguacg uggu guuguc acuucg cggu guacuagauu gagag ag      auagg   a
         a    a      c      u    -          a     g  accuau     uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03614: 2928186-2928311 [-]
intergenic
Database links

Mature sequence mes-miR167f

Accession MIMAT0029206
Sequence

19 - 

ugaagcugccagcaugaucuga

 - 40

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).