Stem-loop sequence mes-MIR167g

AccessionMI0024249 (change log)
DescriptionManihot esculenta miR167g stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

6 open access papers mention mes-MIR167g
(21 sentences)

Stem-loop
   u          g        ua    -     ca 
5'  gaagcugcca caugaucu  aucu cccuc  u
    |||||||||| ||||||||  |||| |||||  c
3'  cuuugacggu guacuaga  uaga gggag  g
   a          -        -c    a     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold10563: 253654-253721 [+]
intergenic
Database links

Mature sequence mes-miR167g

Accession MIMAT0029207
Sequence

1 - 

ugaagcugccagcaugaucuu

 - 21

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).