Stem-loop sequence mes-MIR169a

AccessionMI0024251 (change log)
DescriptionManihot esculenta miR169a stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

10 open access papers mention mes-MIR169a
(29 sentences)

Stem-loop
      c          ga         guuugcuua   a  uauc 
5' aug agccaaggau  cuugccggc         gug cc    u
   ||| ||||||||||  |||||||||         ||| ||    a
3' uac ucgguucuug  gaacggccg         uac gg    g
      a          uc         aacuccaua   -  uuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold12448: 44913-45002 [-]
intergenic
Database links

Mature sequence mes-miR169a

Accession MIMAT0029209
Sequence

4 - 

cagccaaggaugacuugccgg

 - 24

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).