Stem-loop sequence mes-MIR169b

AccessionMI0024252 (change log)
DescriptionManihot esculenta miR169b stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

10 open access papers mention mes-MIR169b
(30 sentences)

Stem-loop
   c     ag             cuagcucuuguagcaugcuuauacuuugcca 
5'  agcca  gaugacuugccgg                               u
    |||||  |||||||||||||                               u
3'  ucggu  cuacugaacggcu                               a
   a     cu             aguagaugaccggucuguguaguaggaauca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold11581: 1504070-1504176 [+]
intergenic
Database links

Mature sequence mes-miR169b

Accession MIMAT0029210
Sequence

1 - 

cagccaaggaugacuugccgg

 - 21

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).