Stem-loop sequence mes-MIR169c

AccessionMI0024253 (change log)
DescriptionManihot esculenta miR169c stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

10 open access papers mention mes-MIR169c
(28 sentences)

Stem-loop
   c     ag                gc      aua     augcuuaua 
5'  agcca  gaugacuugccggcua  ucuagu   cuagu         u
    |||||  ||||||||||||||||  ||||||   |||||         u
3'  ucggu  cuacugaacggcuggu  agauca   gguca         u
   -     cu                --      -ac     auuuaccuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold11341: 672352-672448 [+]
intergenic
Database links

Mature sequence mes-miR169c

Accession MIMAT0029211
Sequence

1 - 

cagccaaggaugacuugccgg

 - 21

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).