Stem-loop sequence mes-MIR169d

AccessionMI0024254 (change log)
DescriptionManihot esculenta miR169d stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

10 open access papers mention mes-MIR169d
(29 sentences)

Stem-loop
       u            uc        - ug          agca   au 
5' gagg agagaguguaau  agccaagg a  acuugccgga    cug  u
   |||| ||||||||||||  |||||||| |  ||||||||||    |||   
3' cuuc uuucucauguua  ucgguucu u  ugaacggccu    ggc  a
       u            ca        u gu          ----   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03874: 50917-51013 [+]
intergenic
Database links

Mature sequence mes-miR169d

Accession MIMAT0029212
Sequence

19 - 

cagccaaggaugacuugccgg

 - 39

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).