Stem-loop sequence mes-MIR169e

AccessionMI0024255 (change log)
DescriptionManihot esculenta miR169e stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

10 open access papers mention mes-MIR169e
(30 sentences)

Stem-loop
       u            uc       -g ug         aaacacug 
5' gagg agagaguguaau  agccaag  a  acuugccgg        c
   |||| ||||||||||||  |||||||  |  |||||||||         
3' cuuc uuucucauguug  ucgguuc  u  ugaacggcc        g
       u            ua       ga gu         guuucuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03049: 886480-886576 [-]
intergenic
Database links

Mature sequence mes-miR169e

Accession MIMAT0029213
Sequence

19 - 

cagccaaggaugacuugccgg

 - 39

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).