Stem-loop sequence mes-MIR169f

AccessionMI0024256 (change log)
DescriptionManihot esculenta miR169f stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

10 open access papers mention mes-MIR169f
(28 sentences)

Stem-loop
   g             ug           aaacucuccauaaauu       gauucau u 
5'  guguagccaagga  acuugccggaa                uucuggu       c u
    |||||||||||||  |||||||||||                |||||||       |  
3'  uacaucgguuccu  ugaacggcuuu                aagacua       g c
   u             gu           ----------------       -auuuuu g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold04233: 350206-350308 [-]
intergenic
Database links

Mature sequence mes-miR169f

Accession MIMAT0029214
Sequence

5 - 

uagccaaggaugacuugccgg

 - 25

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).