Stem-loop sequence mes-MIR169g

AccessionMI0024257 (change log)
DescriptionManihot esculenta miR169g stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

10 open access papers mention mes-MIR169g
(28 sentences)

Stem-loop
       c         ug          cag   c  ----a   a 
5' uaug agccaagga  acuugccgac   ugg cu     uuc a
   |||| |||||||||  ||||||||||   ||| ||     ||| g
3' guac ucgguuccu  ugaacgguug   acc ga     aag a
       a         gu          --a   a  aaacg   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold06582: 708959-709043 [-]
intergenic
Database links

Mature sequence mes-miR169g

Accession MIMAT0029215
Sequence

5 - 

cagccaaggaugacuugccga

 - 25

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).