Stem-loop sequence mes-MIR169h

AccessionMI0024258 (change log)
DescriptionManihot esculenta miR169h stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

10 open access papers mention mes-MIR169h
(28 sentences)

Stem-loop
   g   u            a         cauauauguaugccuaucgu 
5'  ggu gagccaaggaug cuugccgcg                    u
    ||| |||||||||||| |||||||||                     
3'  uca cucgguuccuac gaacggugc                    u
   u   u            -         uuuuaggagaugcaaguuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03264: 411990-412084 [+]
intergenic
Database links

Mature sequence mes-miR169h

Accession MIMAT0029216
Sequence

5 - 

ugagccaaggaugacuugccg

 - 25

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).