Stem-loop sequence mes-MIR169i

AccessionMI0024259 (change log)
DescriptionManihot esculenta miR169i stem-loop
Gene family MIPF0001690; MIR169_7
Literature search

10 open access papers mention mes-MIR169i
(28 sentences)

Stem-loop
        c           g     c   ga    aga    u   g 
5' agagc aagaaugacuu ccggc ggu  ucau   uuau gcu u
   ||||| ||||||||||| ||||| |||  ||||   |||| |||  
3' ucucg uucuuacugaa ggccg ucg  agua   aaug uga a
        -           -     -   --    --a    -   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold12768: 29476-29559 [-]
intergenic
Database links

Mature sequence mes-miR169i

Accession MIMAT0029217
Sequence

2 - 

gagccaagaaugacuugccgg

 - 22

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).