Stem-loop sequence mes-MIR169j

AccessionMI0024260 (change log)
DescriptionManihot esculenta miR169j stem-loop
Gene family MIPF0001690; MIR169_7
Literature search

10 open access papers mention mes-MIR169j
(28 sentences)

Stem-loop
          a         g   gcuagcgauaggcuauauugc 
5' agagcca gaaugacuu ccg                     u
   ||||||| ||||||||| |||                      
3' ucucggu cuuacugaa ggc                     a
          -         g   gucgaaaaaaaaauacggaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold12768: 42242-42326 [-]
intergenic
Database links

Mature sequence mes-miR169j

Accession MIMAT0029218
Sequence

2 - 

gagccaagaaugacuugccgg

 - 22

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).