Stem-loop sequence mes-MIR169k

AccessionMI0024261 (change log)
DescriptionManihot esculenta miR169k stem-loop
Gene family MIPF0001690; MIR169_7
Literature search

10 open access papers mention mes-MIR169k
(28 sentences)

Stem-loop
          a         g   gauaaugauaagcuauauugcu 
5' agagcca gaaugacuu ccg                      a
   ||||||| ||||||||| |||                       
3' ucucggu cuuacugaa ggc                      c
          -         g   gacgaauaaaaaaaauacggaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold12448: 20120-20206 [-]
intergenic
Database links

Mature sequence mes-miR169k

Accession MIMAT0029219
Sequence

2 - 

gagccaagaaugacuugccgg

 - 22

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).