Stem-loop sequence mes-MIR169l

AccessionMI0024262 (change log)
DescriptionManihot esculenta miR169l stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

10 open access papers mention mes-MIR169l
(28 sentences)

Stem-loop
   c         ug          - -uu     gauaga  u  g 
5'  agccaagaa  acuugccgga g   uucuu      gc cc g
    |||||||||  |||||||||| |   |||||      || ||  
3'  ucgguucuu  uggacggccu c   aagaa      ug gg u
   a         gu          g uuc     -----a  u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold11232: 311795-311877 [-]
intergenic
Database links

Mature sequence mes-miR169l

Accession MIMAT0029220
Sequence

1 - 

cagccaagaaugacuugccgg

 - 21

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).