Stem-loop sequence mes-MIR169n

AccessionMI0024264 (change log)
DescriptionManihot esculenta miR169n stem-loop
Literature search

10 open access papers mention mes-MIR169n
(28 sentences)

Stem-loop
        ca                 u   caugagaaugcuca 
5' agagc  agaaugacuugccgacu ggc              a
   |||||  ||||||||||||||||| |||              a
3' ucucg  ucuugcugaacggcugg ccg              a
        -a                 -   uccguugggcagca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold02017: 31157-31241 [-]
intergenic
Database links

Mature sequence mes-miR169n

Accession MIMAT0029222
Sequence

2 - 

gagccaagaaugacuugccga

 - 22

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).