Stem-loop sequence mes-MIR169o

AccessionMI0024265 (change log)
DescriptionManihot esculenta miR169o stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

10 open access papers mention mes-MIR169o
(28 sentences)

Stem-loop
       g  -         u  cu      -c    u  cg  gauuuuucaucuuugcaugaaau 
5' guuu gu agccaagga ga  ugccug  agcu ca  ca                       a
   |||| || ||||||||| ||  ||||||  |||| ||  ||                       a
3' caga ca ucgguuccu cu  acggac  uugg gu  gu                       c
       g  a         -  -u      au    u  au  auaaguuuuggaaucaaucggcg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold08757: 173499-173625 [-]
intergenic
Database links

Mature sequence mes-miR169o

Accession MIMAT0029223
Sequence

7 - 

uagccaaggaugacuugccug

 - 27

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).