Stem-loop sequence mes-MIR169r

AccessionMI0024268 (change log)
DescriptionManihot esculenta miR169r stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

10 open access papers mention mes-MIR169r
(28 sentences)

Stem-loop
                 c      ---    cacu       ca     cuu u 
5' guagccaaggauga uugccc   gcua    gagaagg  uugau   g u
   |||||||||||||| ||||||   ||||    |||||||  |||||   |  
3' uauugguuccuacu aacggg   cggu    uuuuuuc  gauug   c u
                 -      uuu    ---u       aa     --u g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05005: 6216-6310 [-]
intergenic
Clustered miRNAs
< 10kb from mes-MIR169r
mes-MIR169sscaffold05005: 11750-11840 [+]
mes-MIR169tscaffold05005: 7537-7640 [+]
mes-MIR169qscaffold05005: 6485-6593 [-]
mes-MIR169rscaffold05005: 6216-6310 [-]
mes-MIR169pscaffold05005: 2236-2331 [+]
Database links

Mature sequence mes-miR169r

Accession MIMAT0029226
Sequence

2 - 

uagccaaggaugacuugcccg

 - 22

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).